Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

  • Bulundugunuz Sayfa: 
  • Ana Sayfa
  • BioInformatic

Profile HMM (Hidden Markov Model)

Gönderim Temmuz 30th, 2014

Bu makalemde, Hidden Markov Model ‘in Biyoinformatikteki Yeri olan Profile HMM inceliyor olucaz. DNA dizilimlerinde genlerin tespiti biyo informatik alaninda halen zorlu ve ilginc bir sorun olarak bilinmektedir.

Bu kadar cok genomun cok hizli bir sekilde diziye girmesi, biyo informatikte gozlemlenecek tekniklere yol acmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Java Desktop App ile Local Sequence Alignment

Gönderim Temmuz 7th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in Java Desktop Application ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini ve java desktop application orneklerini iyi bir sekilde pekistirmis olabileceksiniz. Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

BioInformatic Assignments

Gönderim Haziran 17th, 2014

Biyoinformatik alaninda calismaniz icin ornek niteliginde isinize yarayabilecek soru ve cevaplari bu makale iceriginde bulabilirsiniz.

 

 

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Java ile Multiple Sequence Alignment (4D)

Gönderim Mayıs 27th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (4 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | 2 Yorum »

Java ile Multiple Sequence Alignment (5D)

Gönderim Mayıs 26th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (5 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Matlab Multialign

Gönderim Mayıs 21st, 2014

Biyoinformatik alaninda multi alignment islevini gerceklestirmeye yarayan multialign komutunun nasil kullanilacagi hakkinda bilgiyi makale icerisinden edinebilirsiniz. Ayni zamanda uygulamayi yaparken ilgili fasta file’larin icerikleride bulunmaktadir.

 

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Java ile Local Sequence Alignment

Gönderim Mayıs 17th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Protein Dizisi Hizalama

Gönderim Mayıs 5th, 2014

Bu makalemde basit bir mantikla protein zincirlerlerinde hizalamalari java yardimiyla eslestirmeye calisicaz.

Yapilan bu calisma ile ayni zamanda java’da string kontrollerini pekistirmis olucaksiniz.

Calisma sonucunda ornek olarak kullanabileceginiz protein dizilimleride bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Blosum62 Hesaplama

Gönderim Nisan 25th, 2014

Biyoinformatik alaninda protein dizilerinin hesaplanmasi konusu onemlidir ve dikkatlice yapilmasi gerekir. Dizi hizalamanin en onemli gorevi farkli DNA, RNA veya protein dizilimlerinin birbirine en cok benzer alanlarinin tespit edilmesidir. Dizi hizalamarinda temel yaklasim olarak hesaplama islemleri puanlama sistemine dayanmaktadir. Bunun icin en cok kullanilan algoritmanin BLAST oldugunu soyleyebilirim. Yapmis oldugum uygulamada, en basit seklinde bir Protein diziliminin hesaplamasi icin BLOSUM62 yontemini kullaniyor olucaz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Global ve Local Alignment

Gönderim Mart 21st, 2014

Hizalama turleri kullanilan algoritmalarina gore Global ve Local Alignment’lar olarak ikiye ayrilmaktadir.

Global alignment; Needleman & Wunsch algoritmasini kullanir.

Local alignment ise Smith & Waterman algoritmasini kullanmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Istatistik

  • 1 Uye
  • 334 Yazi
  • 16 Yorum Var