Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Global ve Local Alignment

Gönderim Mart 21st, 2014

Hizalama turleri kullanilan algoritmalarina gore Global ve Local Alignment’lar olarak ikiye ayrilmaktadir.

Global alignment; Needleman & Wunsch algoritmasini kullanir.

Local alignment ise Smith & Waterman algoritmasini kullanmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Istatistik

  • 1 Uye
  • 334 Yazi
  • 16 Yorum Var