Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

Arduino ile Kriptoloji Uygulamasi

Gönderim Eylül 7th, 2014

arduinoArduino temel olarak acik kaynakli bir gelistirme platformuna sahip cevresiyle etkilesimli calisabilen sistemler tasarlayabileceginiz bir fiziksel programlama platformudur. Kullanici tarafindan girilen metinlerin nukleotid bazlarina donusturulmesi ya da girilen nukleotid dizilimlerinin metine donusturulmesini saglayan ve arduino uzerinde calisan bir sifreleme programidir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, Arduino, C / C++, Gomulu Sistem / Embedded System, Sistem Programlama, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Istatistik

  • 1 Uye
  • 334 Yazi
  • 16 Yorum Var