Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

Java ile Blosum62 Hesaplama

Gönderim Nisan 25th, 2014

Biyoinformatik alaninda protein dizilerinin hesaplanmasi konusu onemlidir ve dikkatlice yapilmasi gerekir. Dizi hizalamanin en onemli gorevi farkli DNA, RNA veya protein dizilimlerinin birbirine en cok benzer alanlarinin tespit edilmesidir. Dizi hizalamarinda temel yaklasim olarak hesaplama islemleri puanlama sistemine dayanmaktadir. Bunun icin en cok kullanilan algoritmanin BLAST oldugunu soyleyebilirim. Yapmis oldugum uygulamada, en basit seklinde bir Protein diziliminin hesaplamasi icin BLOSUM62 yontemini kullaniyor olucaz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java String Kontrolleri

Gönderim Nisan 2nd, 2014

java Bu yazimda sizlere java’da kullanilan bazi string kontrollerinden bahsediyor olucam.

Onceden belirlemis oldugunuz string’in belirli baslangic ve sonuc indexleri tanimlandiktan sonra string icerisinden o ifadeyi nasil cekebilecegimizi gorucez. Bu islemleri gerceklestirirken ornegimizde  indexOf ve substring kontrollerinin kullanisi hakkinda bilgi sahibi olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java MySql Connection

Gönderim Nisan 1st, 2014

javamysql Bu makalerde, Java – MySql veri tabanina baglanti yapabilmek icin gerekli olabilecek java kodlarindan bahsediyor olucam.

Bu islemi yaparken sql cumlenizi baglantiyla ilgili metoda gondererek daha rahat bir sekilde yapabileceksiniz. Ayni zamanda try-catch blogunu kullanarak islem sureclerinde hataya yakalanip yakalanmadiginizi kontrol edebiliyor olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Istatistik

  • 1 Uye
  • 334 Yazi
  • 16 Yorum Var